rs366327 chr4:87058878 A>T
- Sequence
ccactgcctctgccggcaggagcc[A/T]ctagtggactgtattggatgaatt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- SMCA4_HUMAN REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | -0.22 | 2.29 | 1.50 | n/a | n/a | |||
| REST_HUMAN | n/a | 2.33 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Colon_Sigmoid, Esophagus_Muscularis, Muscle_Skeletal, Thyroid