rs366658 chr8:8930369 A>T
- Sequence
gctatggggcagatggtcgagggg[A/T]ccacctagtgggacgtgaagacaa
- ASB in cell types
- MDM(monocyte derived macrophages) MS-1 (Small cell lung carcinoma) GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- TF65_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.76 | -0.76 | 4.00 | n/a | No Hit | |||
| CTCF_HUMAN | 0.31 | 1.52 | 1.44 | 0.70 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood