rs367116 chr8:59017003 C>T
- Sequence
ataacttctggctgaagatgtcta[C/T]attgctccttcactgtttatagcc
- ASB in cell types
- MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.35 | 1.67 | 1.48 | n/a | No Hit | |||
| STAG1_HUMAN | 1.15 | 2.64 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, abnormal involuntary movement scale, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, asthma, fasting insulin, height, homa-b, homa-ir, infant head circumference, late onset alzheimers disease, ldl cholesterol, partial epilepsy, schizophrenia, transmission distortion, triglycerides change with statins, type 1 diabetes, combined control dataset, urinary albumin-to-creatinine ratio, waist hip ratio