rs367389 chr19:3305054 T>C
- Sequence
tgcactccagcttgggcgacagaa[T/C]gagacttttttttaaaattacttt
- ASB in cell types
- erythroid cells CD34+ stem cells-derived erythroblasts MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 1.92 | -3.55 | 1.50 | |||
| CD34+ stem cells-derived erythroblasts | 2.96 | 1.20 | 2.00 | |||
| MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line) | -0.73 | 1.15 | 1.00 |
Items per page:
1 – 3 of 3