rs367586 chr1:109307500 C>A
- Sequence
cctttacagggcctgtcccatcct[C/A]ccccgctccccgggggcagcgggc
- ASB in cell types
- K562 (myelogenous leukemia) iPS-derived dermal fibroblasts
- ASB for transcription factors
- ARI1B_HUMAN COT1_HUMAN EGR1_HUMAN KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | 2.11 | n/a | 1.00 | n/a | n/a | |||
| COT1_HUMAN | 2.50 | -2.50 | 1.00 | n/a | No Hit | |||
| EGR1_HUMAN | 3.55 | -3.69 | 2.00 | -4.19 | Concordant | |||
| KDM1A_HUMAN | 1.69 | -0.51 | 1.00 | n/a | n/a | |||
| CTBP1_HUMAN | 2.63 | -2.42 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 25
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Uterus, Whole_Blood