rs369421 chr10:8057214 C>T
- Sequence
ctccactcccctccccttcctctc[C/T]cttaagattttagtttcagtattg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM17942 (lymphoblastoid cell) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -1.16 | 1.83 | 1.00 | |||
| GM17942 (lymphoblastoid cell) | 2.35 | -1.88 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.19 | 0.69 | 1.17 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, classical hodgkins lymphoma, hdl cholesterol, rheumatoid arthritis, total cholesterol