rs36987 chr5:1499060 C>T
- Sequence
acgtgtcactgtcacgggacactt[C/T]acacgtgcatgagatgtacatatg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | n/a | 2.08 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), chronic kidney disease, cystatin c in serum, diabetic retinopathy in type 2 diabetes mellitus, fasting insulin, hdl cholesterol change with statins, homa-ir, ldl cholesterol change with statins, mitral annular calcium, total cholesterol change with statins