rs371586 chr5:151165059 T>C
- Sequence
agacaggtcttacttcaagctcac[T/C]agaggaaggggccccaagggatac
- ASB in cell types
- HEK293 (embryonic kidney) H929 (plasma cell myeloma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -2.33 | 1.48 | 1.50 | |||
| H929 (plasma cell myeloma) | 1.94 | n/a | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.63 | 0.91 | 1.11 |
Items per page:
1 – 3 of 3