rs371824 chr13:42224498 C>G
- Sequence
ctaactggtctttccgctgccact[C/G]tgtcttcacagtccattatccacg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -2.75 | 2.65 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, lp-pla2 activity, microalbuminuria, obesity with early age of onset (age >2), triglycerides, urinary albumin-to-creatinine ratio