rs372143 chr14:68120621 T>C
- Sequence
accacatctgagaaggacaggtct[T/C]ctgcttcaaggtgggttttttttt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.99 | -0.33 | 1.17 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, diastolic blood pressure (dbp), height, ldl cholesterol, psoriasis and/or psoriatic arthritis, psoriasis only (no arthritis), systolic blood pressure (sbp), total cholesterol, years of education