rs372225 chr9:125261770 A>G
- Sequence
cccgggcggaactacagctcccag[A/G]ggcccccgcggcgctgcgcacgcg
- ASB in cell types
- fetal bone marrow-derived mononuclear cells adult erythroblasts HeLa (cervical adenocarcinoma) erythroid cells
- ASB for transcription factors
- HCFC1_HUMAN ZN143_HUMAN KMT2A_HUMAN CTCFL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HCFC1_HUMAN | 0.90 | 1.28 | 2.50 | n/a | n/a | |||
| ZN143_HUMAN | 1.10 | -2.28 | 1.33 | -1.18 | Weak Concordant | |||
| KMT2A_HUMAN | 0.20 | 3.20 | 1.25 | 0.91 | Weak Concordant | |||
| CTCFL_HUMAN | -0.79 | 2.24 | 2.00 | 1.39 | Weak Concordant | |||
| INT11_HUMAN | 1.09 | 1.72 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 7
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood