rs372826 chr4:71710184 C>A
- Sequence
tctgagctcccccacgtggagaga[C/A]agtttctaattcctcagaatttta
- ASB in cell types
- epithelial cell of prostate GM19238 (female B-cells lymphoblastoid cell lines) GM02610 (Lymphoblastoid Cell Lines) GM18951 (B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.17 | 1.46 | 1.40 | n/a | No Hit | |||
| STAG1_HUMAN | -1.15 | 1.70 | 1.07 | n/a | n/a |
Items per page:
1 – 2 of 2