rs3737966 chr1:11787702 C>T
- Sequence
ccgcccctgtgatttctctttggg[C/T]ggcaggcagccgggagaggctgga
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- HDAC1_HUMAN LMBL2_HUMAN ARNT_HUMAN MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC1_HUMAN | 2.20 | -0.89 | 1.00 | n/a | n/a | |||
| LMBL2_HUMAN | 2.95 | -2.83 | 1.00 | n/a | n/a | |||
| ARNT_HUMAN | 2.49 | -0.63 | 1.00 | n/a | No Hit | |||
| MNT_HUMAN | 2.08 | -0.64 | 1.00 | n/a | No Hit | |||
| ARI1B_HUMAN | 2.03 | -1.80 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 10
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood