rs3740065 chr10:99845936 A>G
- Sequence
ctagttccctaggatggacacgtc[A/G]tttccagaactttgaaatgtttgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CAR-T cells gastroesophageal sphincter erythroid progenitors
- ASB for transcription factors
- IRF4_HUMAN CTCF_HUMAN IKZF2_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IRF4_HUMAN | 3.12 | -2.76 | 1.00 | n/a | No Hit | |||
| CTCF_HUMAN | 0.54 | 0.58 | 1.27 | n/a | No Hit | |||
| IKZF2_HUMAN | 1.80 | -1.45 | 1.00 | n/a | n/a | |||
| STAG1_HUMAN | 0.38 | -0.15 | 1.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), drug-induced liver injury, drug-induced liver injury-all dili cases with time to onset less than or equal to the median of 24 days, drug-induced liver injury-risk of dili due to any drug, drug-induced liver injury-to all dili cases with age of onset greater than the median of 57.5 years, lp-pla2 mass, serum creatinine, systolic blood pressure (sbp), total cholesterol change with statins