rs3740491 chr10:100997143 C>G
- Sequence
agttcggaacctagagttcggagc[C/G]ggctagggagccggcgttgtcgcg
- ASB in cell types
- primary B-CLL cells breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -1.74 | 2.53 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg