rs3741202 chr11:18013045 G>C
- Sequence
tccgccggcgcttccgggagggac[G/C]gcacgggggcggcgcctgccgggg
- ASB in cell types
- pancreas prostate gland esophagus squamous epithelium GM02630 (Fanconi anemi)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN BHE40_HUMAN RAG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.12 | 2.52 | 1.43 | 4.60 | Concordant | |||
| STAG1_HUMAN | -0.28 | 1.53 | 1.05 | n/a | n/a | |||
| BHE40_HUMAN | 0.76 | n/a | 1.50 | -0.07 | Weak Concordant | |||
| RAG2_HUMAN | 2.24 | -2.06 | 1.00 | n/a | n/a | |||
| KMT2A_HUMAN | 1.87 | -0.51 | 1.00 | -1.09 | Weak Concordant |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood