rs3742300 chr13:52847297 C>A
- Sequence
cgccggcgagctagcgtccgctcc[C/A]ccgagtgcagcggcggcggcggca
- ASB in cell types
- HL-60 (acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HL-60 (acute myeloid leukemia) | 2.81 | -4.81 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Thyroid