rs3742720 chr14:80941960 T>G
- Sequence
tcttgccctgctctattttttttt[T/G]ttgttaaaggaccagcctcctttg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) LoVo (colorectal adenocarcinoma) breast tumor 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ZN143_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN143_HUMAN | -0.70 | 1.91 | 1.31 | n/a | No Hit | |||
| ANDR_HUMAN | 2.48 | -1.70 | 1.50 | -2.26 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP college completion, cystatin c in serum, refractive error, salmonella-induced pyroptosis, total cholesterol, urinary albumin-to-creatinine ratio