rs3742887 chr14:68795724 A>G
- Sequence
agttgtttaccggccccgccgacc[A/G]agggtttgttccagctcccagagc
- ASB in cell types
- primary B-CLL cells naive IgD+ B cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | n/a | 2.00 | 3.00 | |||
| naive IgD+ B cells | 2.58 | -1.59 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, college completion, mitral annular calcium, rheumatoid arthritis