rs3743040 chr15:80977800 G>A
- Sequence
ctcccgctccaggttcaagatgca[G/A]gaggaacaagaaaagcctctttca
- ASB in cell types
- THP-1 (acute monocytic leukemia) H929 (plasma cell myeloma) GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.35 | 1.05 | 1.00 | |||
| H929 (plasma cell myeloma) | 2.81 | -2.61 | 1.00 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -0.52 | 1.57 | 1.00 |
Items per page:
1 – 3 of 3