rs3743313 chr15:70505803 C>T
- Sequence
ctcactctacttctattaaatccc[C/T]ttcccttgaggatattaatgggaa
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | n/a | 2.55 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, hdl cholesterol change with statins, homa-b, mitral annular calcium, prop taste detection threshold, salmonella-induced pyroptosis