rs3743566 chr16:58511881 C>T
- Sequence
agggagattcgctacggatccagg[C/T]cattcctgggtgagcccttgggca
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.54 | 1.16 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, age-related hearing impairment, aortic valve calcium, barnes akathisia rating scale, birth weight, obesity with early age of onset (age >2), simpson-angus scale
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Pituitary, Testis, Thyroid