rs3743589 chr16:11742888 A>T
- Sequence
gccgcggggtccgccccacctcac[A/T]ccccagagcacgcagctccgccca
- ASB in cell types
- HEK293 (embryonic kidney) HMEC (human mammary epithelial cells) T47D (invasive ductal carcinoma) breast tumor
- ASB for transcription factors
- RBM25_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | -0.17 | 1.01 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1