rs3744246 chr17:39928097 T>C
- Sequence
gagagcgcttttcacaacattggc[T/C]gggatgagggtctggagggcccgg
- ASB in cell types
- HepG2 (hepatoblastoma) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.32 | 1.10 | 1.00 | n/a | No Hit | |||
| ANDR_HUMAN | -0.88 | 2.41 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP asthma, asthma (childhood asthma), asthma, childhood and later onset, asthma, childhood onset, asthma, childhood, later and unknown onset, and severe and industrial asthma, asthma, childhood, later and unknown onset, and severe asthma, asthma, later onset, hdl cholesterol, irritible bowel syndrome, severe asthma, sporadic creutzfeldt-jakob disease, transmission distortion, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood