rs3744619 chr17:31517640 C>G
- Sequence
cctcacttatcttgtctctgctct[C/G]tctttcccagggcagcgaggtcac
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.51 | 0.14 | 1.05 | n/a | n/a |
Items per page:
1 – 1 of 1