rs3744652 chr17:8435965 C>T
- Sequence
gctgcgtaggggagctgagccgag[C/T]ggctgggcgggcctggccgggccg
- ASB in cell types
- fetal bone marrow-derived mononuclear cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| fetal bone marrow-derived mononuclear cells | 2.86 | n/a | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Colon_Sigmoid, Esophagus_Muscularis, Nerve_Tibial, Thyroid