rs3744996 chr18:45910637 G>A
- Sequence
acggagggccttgcttgcagcatg[G/A]tggaagtcagccacctcggtcaaa
- ASB in cell types
- hepatocytes CD34+ stem cells-derived erythroblasts gastroesophageal sphincter GM18505 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.23 | 0.98 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, adiponectin levels, body mass index (bmi), diastolic blood pressure (dbp), eye color, systolic blood pressure (sbp), years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid