rs3745298 chr19:49155110 C>T
- Sequence
tcggagagcccggcgactccagtg[C/T]tgttgttccggtttctgaagccta
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- GABP1_HUMAN SP130_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABP1_HUMAN | -2.11 | 2.50 | 1.00 | n/a | n/a | |||
| SP130_HUMAN | -1.70 | 2.26 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), comorbid depressive syndrome and alcohol dependence
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Lung, Muscle_Skeletal, Pituitary, Spleen, Testis, Whole_Blood