rs3745452 chr19:55467857 C>T
- Sequence
tcttatttcaaaatttgcattcca[C/T]agtccaggggccaagagcaacatc
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte hepatocytes
- ASB for transcription factors
- NR2C1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR2C1_HUMAN | -0.42 | 2.17 | 2.00 | 0.41 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid