rs3745607 chr19:47274404 C>T
- Sequence
tggtcggggtgtcgcgcgggaacc[C/T]gcgcgggaggagagcggggattcc
- ASB in cell types
- HMEC (human mammary epithelial cells) HCC1954 (ductal breast carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- NRF1_HUMAN PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | n/a | 3.79 | 1.67 | 2.83 | Concordant | |||
| PKNX1_HUMAN | -2.24 | 2.67 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood