rs3745836 chr19:56141223 G>A
- Sequence
gggagttgttgggctgaacgagcg[G/A]ctcggagtatgggattgggggagg
- ASB in cell types
- MDM(monocyte derived macrophages) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- TF65_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | n/a | 3.09 | 3.00 | n/a | No Hit | |||
| ANDR_HUMAN | -1.94 | 2.89 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, microalbuminuria, paternal transmission distortion, type 2 diabetes, combined control dataset, gender differentiated, urinary albumin-to-creatinine ratio