rs3746198 chr19:17606087 G>T
- Sequence
aggcgcggcaccgccctcctcggc[G/T]gagcgcgtgtccgacttgagcttc
- ASB in cell types
- HMEC (human mammary epithelial cells)
- ASB for transcription factors
- NRF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | -3.41 | 2.16 | 1.33 | 0.33 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
