rs3746317 chr19:17556110 C>T
- Sequence
gcgcgtgcttcctgctcgctaccc[C/T]catcgggacggttctacgcatgcc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) monocytes from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.18 | 0.75 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.82 | 0.06 | 1.98 | |||
| monocytes from periferal blood | 1.77 | -4.51 | 2.50 |
Items per page:
1 – 3 of 3