rs3746651 chr20:62143364 C>T
- Sequence
tctcaaaagcgcacactcacggcc[C/T]gcgcgcacccgcgactcccggcgc
- ASB in cell types
- 22RV1 (prostate carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 0.07 | 2.02 | 1.36 | |||
| HEK293 (embryonic kidney) | -0.04 | 0.87 | 2.04 |
Items per page:
1 – 2 of 2