rs3747148 chr22:29883376 C>T
- Sequence
gctgcccggtaagaaccccatccc[C/T]gtcctccgtctcctcggcgggtga
- ASB in cell types
- primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 1.91 | -0.26 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Muscularis, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Thyroid