rs374749 chr5:5752220 T>C
- Sequence
agggaagaaagcctcagaccggca[T/C]gtgcacagcttcttaaacacactg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM02630 (Fanconi anemi)
- ASB for transcription factors
- BHE40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BHE40_HUMAN | n/a | 3.95 | 1.33 | 4.80 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, serum creatinine, triglycerides change with statins