rs374767 chr8:17699849 G>A
- Sequence
caagcactctcttacacactttac[G/A]tttgctcatttaaataactggata
- ASB in cell types
- glioblastoma cells H929 (plasma cell myeloma) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 1.74 | -1.75 | 1.50 | |||
| H929 (plasma cell myeloma) | 1.38 | n/a | 2.00 | |||
| THP-1 (acute monocytic leukemia) | 0.75 | 0.06 | 2.00 |
Items per page:
1 – 3 of 3