rs3748393 chr16:87317167 C>A
- Sequence
ccgcgcccggccccccggcagcag[C/A]gcctgaggctgctccagtggcctc
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte
- ASB for transcription factors
- ZN335_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN335_HUMAN | n/a | 1.70 | 2.00 | -1.22 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
