rs3748861 chr2:132438879 C>A
- Sequence
ctccattagtcatttcctggcttc[C/A]atggctgtcggaattcccctgctc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) HAEC (human aortic endothelial cells) HCT-116 (colon carcinoma) RCC 7860 (Renal cell carcinoma)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.34 | 0.42 | 2.15 | n/a | No Hit |
Items per page:
1 – 1 of 1