rs3749034 chr2:170816965 G>A
- Sequence
tggaggtgacgccgggcagattac[G/A]cctgtcagggccgagccgagcgga
- ASB in cell types
- K562 (myelogenous leukemia) neural progenitors MOLM14 (Adult acute myeloid leukemia) HepG2 (hepatoblastoma)
- ASB for transcription factors
- TAF9B_HUMAN MNT_HUMAN NRF1_HUMAN VEZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAF9B_HUMAN | 3.50 | -3.84 | 1.00 | n/a | n/a | |||
| MNT_HUMAN | 2.61 | -0.67 | 1.00 | n/a | No Hit | |||
| NRF1_HUMAN | 2.44 | -1.73 | 1.00 | n/a | No Hit | |||
| VEZF1_HUMAN | 2.50 | -1.66 | 1.00 | n/a | No Hit | |||
| NELFA_HUMAN | 2.50 | -4.89 | 1.50 | n/a | n/a |
Items per page:
1 – 5 of 12
Motif analysis
No data available
Genetic associations
GRASP asparaginase sensitivity in cell lines, asthma, prop taste detection threshold, pulmonary arterial hypertension (pah), refractive error
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Thyroid