rs3749147 chr2:27629051 G>A
- Sequence
tctatggtcgggtgggtggggcca[G/A]gaggaagatggcggcgtccgcagc
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) CD14+ monocytes HEK293 (embryonic kidney)
- ASB for transcription factors
- STAT1_HUMAN NELFA_HUMAN NONO_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 3.37 | -3.77 | 2.00 | n/a | No Hit | |||
| NELFA_HUMAN | 1.70 | -1.94 | 1.50 | n/a | n/a | |||
| NONO_HUMAN | 2.21 | -0.06 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
EMBL-EBI fasting blood glucose adjusted for bmi, fasting blood insulin adjusted for bmi, waist circumference - triglycerides (wc-tg)
GRASP 2 hour glucose, adiponectin levels, cystatin c in serum, fasting blood glucose, homa-ir, plasma palmitoleic acid, plasma protein-c levels, serum creatinine, serum urate, total cholesterol, total cholesterol change with statins, triglycerides, triglycerides change with statins, waist circumference and triglycerides, waist hip ratio
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood