rs3749376 chr3:24496776 G>T
- Sequence
gcaggcggccccctggtggctaac[G/T]gggggtgagaaagctggccactga
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) GM19239 (male B-cells lymphoblastoid cell line) HeLa (cervical adenocarcinoma) GM19193 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.58 | 1.47 | 1.50 | 0.28 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
