rs3749521 chr4:337877 G>C
- Sequence
cttcatctctctgcgttctcagtt[G/C]tgggaggccttggtgattcggcca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) TTC-1240 (Rhabdoid tumor of the kidney) CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.75 | -1.09 | 1.50 | 2.82 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
