rs3749544 chr4:16226200 G>A
- Sequence
ccggggttccaaggcgcccccgcc[G/A]ccctcggtccccagtccgcccctc
- ASB in cell types
- HepG2 (hepatoblastoma) MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | -1.66 | 2.61 | 2.00 | 1.06 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
