rs3750502 chr9:12776517 C>A
- Sequence
ttgcagcctttcctcctagctcac[C/A]cttccaccagtaccgctccgccct
- ASB in cell types
- neural cell breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.18 | 1.05 | 1.00 | |||
| breast tumor | 2.19 | n/a | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, spine bone mineral density (bmd), systolic blood pressure (sbp), total cholesterol
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra