rs3750710 chr10:100267608 T>C
- Sequence
tctgtgccatctgtccgaatagta[T/C]gggttgcgactgccacctaaaatt
- ASB in cell types
- HCT-116 (colon carcinoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | 0.93 | -0.25 | 1.77 | |||
| A549 (lung carcinoma) | 0.10 | 0.88 | 2.00 |
Items per page:
1 – 2 of 2