rs3750861 chr10:3782241 C>T
- Sequence
gtgcaaaatgaaccagagaaggca[C/T]gtgattgccatgacgaccaaaagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 2.76 | -4.76 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, comorbid depressive syndrome and alcohol dependence, hip bone mineral density (bmd), hypertension (early onset hypertension), lung cancer, prop taste detection threshold, rheumatoid arthritis