rs3751254 chr12:2583020 T>G
- Sequence
cacagtgccaaacgggcacgcccc[T/G]caggtccgggcggtcctgctcggg
- ASB in cell types
- erythroid cells esophagus squamous epithelium
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | n/a | 2.38 | 1.50 | |||
| esophagus squamous epithelium | 2.17 | 0.11 | 1.00 |
Items per page:
1 – 2 of 2