rs3751723 chr16:54286285 G>T
- Sequence
cgaacagattggcggagattcccg[G/T]ggctccgggctctgattgacattt
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLM14 (Adult acute myeloid leukemia) | 1.07 | 0.28 | 1.00 |
Items per page:
1 – 1 of 1