rs3751940 chr17:80949378 C>T
- Sequence
tgccaggaagggctcttaccacca[C/T]gcacagagcacaggccaggccatc
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -1.07 | 1.65 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellum, Brain_Cortex, Colon_Sigmoid, Muscle_Skeletal